Email updates

Keep up to date with the latest news and content from Acta Veterinaria Scandinavica and BioMed Central.

Open Access Highly Accessed Case report

Anaplasma phagocytophilum infection in a domestic cat in Finland: Case report

Helka M Heikkilä1*, Anna Bondarenko2, Andrea Mihalkov2, Kurt Pfister2 and Thomas Spillmann1

Author Affiliations

1 Department of Equine and Small Animal Medicine, Faculty of Veterinary Medicine, P.O. BOX 57, 00014 University of Helsinki, Helsinki, Finland

2 Institute of Comparative Tropical Medicine and Parasitology, Leopoldstr. 5, 80802 Munich, Germany

For all author emails, please log on.

Acta Veterinaria Scandinavica 2010, 52:62  doi:10.1186/1751-0147-52-62


The electronic version of this article is the complete one and can be found online at: http://www.actavetscand.com/content/52/1/62


Received:12 July 2010
Accepted:15 November 2010
Published:15 November 2010

© 2010 Heikkilä et al; licensee BioMed Central Ltd.

This is an Open Access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by/2.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.

Abstract

Background

Anaplasmosis is a vectorborne disease caused by the gram-negative bacterium Anaplasma phagocytophilum. This species displays positive tropism to granulocytes and can cause illness in several mammalian species, including cats, dogs, and humans. It is considered as an emerging disease in Europe. The clinical signs are nonspecific and include fever, lethargy, and inappetence. The most typical hematologic abnormality is thrombocytopenia. A tentative diagnosis can be made by detecting intracytoplasmic morulae inside neutrophils. The diagnosis is confirmed by PCR and serology in paired serum samples. A sample for PCR analysis should be taken before treatment. Anaplasmosis is treated with doxycycline.

Case presentation

A feline case of anaplasmosis is presented. The history, clinical presentation, diagnostics, treatment, and follow-up are discussed.

Conclusions

This case indicates that Anaplasma phagocytophilum infects cats in Finland. To provide accurate treatment, anaplasmosis should be listed as a differential diagnosis in cats suffering from acute febrile illness with previous tick exposure.

Background

Anaplasmosis is a vectorborne disease caused by the gram-negative bacterium Anaplasma phagocytophilum (encompassing the former Ehrlichia phagocytophila, Ehrlichia equi, and the human granulocytic ehrlichiosis agent) [1]. Although anaplasmosis has been known for decades as a tickborne fever affecting domestic ruminants in Europe [2], A. phagocytophilum can also infect several other mammalian species, including dogs [3], horses [4], cats [5], small rodents [6], cervids [6-9], European bison [2], wild boars, red foxes, European hares [9], donkeys [10], and humans [11].

The bacterium has been detected in almost all European countries [2,12]. In Finland A. phagocytophilum infection has previously been reported only in cattle [13]. This is the first reported case of anaplasmosis in a cat as well as in any companion animal in Finland.

Case presentation

History

A 3.5-year-old sterilized female Maine coon cat was brought to the Veterinary Teaching Hospital of Helsinki University with lethargy and poor appetite in July 2008. The cat had symptoms for 3 days, including hiding, ocular discharge, and not drinking, urinating, or defecating during that period. The symptoms began immediately after returning from a summer cottage in southeastern Finland, where the cat was often kept outdoors on a leash. The owner noticed two ticks attached to the cat's skin, 1 day before the appointment. The cat was previously healthy except for suspected endometriosis treated with ovariohysterectomy 1 year before.

Clinical presentation

The abnormal findings in the clinical examination were fever (39.5°C), tachypnea, bilaterally increased lung sounds, slightly painful cranial abdomen, and discharge in both eyes. Additionally, the cat had four skin lesions, indicating previous tick exposure. One Ixodes ricinus tick was found attached.

Diagnostics

Thoracic and abdominal radiographs were obtained. Venous blood sample was taken into EDTA and heparin tubes. The complete blood count and biochemistry profile were analyzed. The radiographs showed no abnormal changes except for minimal bronchial pattern in the lungs. Lymphopenia (lymphocytes 0.4 × 109/L; reference range 1.3 - 7.5 × 109/L) and mild hyperglycemia (glucose 7.7 mmol/L; reference range 3.5 - 5.7 mmol/L) were identified as the only abnormalities in the blood sample. However, when the blood smear was analyzed, we detected intracytoplasmic morulae in the neutrophils. After viewing the morulae, we confirmed the diagnosis of anaplasmosis by PCR analysis at the laboratory of the Institute of Comparative Tropical Medicine and Parasitology in Munich, Germany. The sample was tested by a modified real-time PCR [14] targeting the msp2 gene of A. phagocytophilum (primers msp25 [5'TTATGATTAGGCCTTTGGGCATG -3'] and msp23 [5'-TCAGAAAGATACACGTGCGCCC-3'] [15]). The reaction was carried out in a BioRad iCycler iQ (BioRad, Munich, Germany) under cycling conditions comprising an initial activation (95°C, 15 min), followed by 50 cycles denaturation (94°C, 15 s), and annealing-extension (60°C, 60 s). DNA of an infected dog and sterile water were used as a positive and negative control, respectively.

Treatment

Initially, the cat was given subcutaneous injections of amoxicillin clavulanic acid (14 mg/kg), metoclopramide (0.4 mg/kg), ranitidine (2.1 mg/kg), meloxicam (0.3 mg/kg), and subcutaneous fluid therapy with Ringer's lactate. The treatment was changed to oral doxycycline (8, 4 mg/kg twice daily for 30 days) the next day after finding the morulae and with improved appetence of the cat. Percutaneous fipronil (8.4 mg/kg) was prescribed for once monthly administration to prevent further tick infestation.

Follow-up

At the control visit 30 days after initiating the treatment, the owner reported that the cat was clinically healthy. There were no abnormal findings in clinical examination, except for tachypnea. A serum biochemistry profile and complete blood count were obtained. The A. phagocytophilum antibody titer was analyzed. No significant hematological or biochemical abnormalities were detected; lymphocytes were also within the reference range. The A. phagocytophilum IgG antibody titer was > 1:128. A titer of 1:32 or more was regarded as positive.

Discussion

Anaplasma phagocytophilum is transmitted by various ticks, Ixodes ricinus being the vector in Europe [1,12,16,17]. Transovarial transmission in ticks does not occur [1,18] and the pathogen is maintained in the environment by a wide range of hosts such as grazing domestic ruminants, wild rodents [18], and cervids [19]. There is some evidence that migratory birds may facilitate the dispersal of infected ticks to new regions [20]. The prevalence of A. phagocytophilum infection has not been studied in competent reservoir animals or birds in Finland, but the pathogen was recently found in Ixodes ricinus ticks from the southeastern part of the country (E. Hasu, unpublished data). Interestingly, the present cat had been outdoors in the same region. Anaplasma phagocytophilum has previously been detected in ticks in all of the neighboring countries; Estonia [21], European Russia [16], Sweden [22], and Norway [23].

The clinical manifestation of anaplasmosis varies widely and is believed to be at least partially host-dependent [24,25]. In a recent study of experimental anaplasmosis in sheep, the severity of the clinical manifestation also varied among different strains of the bacteria [25]. The clinical signs of anaplasmosis in cats resemble those of the disease in dogs. In both species the most common manifestation is an acute febrile illness with lethargy and inappetence [5,17,24,26], as shown here. The cat also showed other nonspecific symptoms. Various other symptoms have been reported in cats, including tachypnea, hyperesthesia, muscle and joint pain, lameness, neck rigidity, lymphadenomegaly, gingivitis, periodontitis, conjunctivitis, weight loss, vomiting, pharyngitis, polydipsia, hematuria, and neurological problems such as tremors, incoordination, and shyness [27]. Anaplasmosis causes immunosuppression [27,28], and some of the many symptoms reported in cats may have been caused by opportunistic infections. The present cat showed tachypnea with mild bronchial pattern in the lungs. Tachypnea persisted after treatment and may have been caused by the stress involved in examination, since there was no evidence for a pulmonary infection.

The most commonly reported hematologic abnormality in anaplasmosis is thrombocytopenia [5,17,24,29], which is assumed to be caused by destruction of the platelets [30]. Thrombocytopenia is mild to moderate in cats [5,17] and moderate to severe (< 50 × 109/L) in dogs [29]. The cat presented here did not have thrombocytopenia, but lymphopenia, which is consistent with previous reports of feline anaplasmosis. Other reported hematologic abnormalities include neutrophilia with left shift and anemia. The combination of different hematological abnormalities varies [5,17,27,28] and is most probably related to the duration of infection prior to sampling. Monoclonal gammopathy and hyperglycemia were reported as serum biochemical abnormalities in feline anaplasmosis [5,17,24,27,29]. The present cat had hyperglycemia. As discussed in previous reports, this was likely attributed to stress. The nonspecific symptoms of feline anaplasmosis can resemble a wide range of other diseases, including other systemic infections, immune-mediated diseases, and neoplasia. As in the present case, a tentative diagnosis of anaplasmosis can be made by direct microscopic examination of May-Grünwald-Giemsa-, Wright-, or Romanowsky-stained peripheral blood smears. The bacterium appears as a single inclusion with a diameter of 0.54 - 1.3 microns, or as colonies (morulae) of 1.5 - 5.0 microns in the cytoplasm of infected neutrophilic and eosinophilic granulocytes [27,30-32] (Figure 1). In feline experimental infection with A. phagocytophilum, intracytoplasmic inclusions appeared in neutrophils in 7 - 9 days [28]. The number of infected cells varies from 1% to 24% in different reports. The morulae can be detected only in the acute stage of the disease [5,27], without pre-treatment with antibiotics [31]. No infected cells were found in the peripheral blood smear of the present cat after a 30-day course of doxycycline. In the first reported feline case of anaplasmosis in Sweden in 1999, the previously infected cells could no longer be identified after 15 days of antibiotic therapy [5].

thumbnailFigure 1. Microscopic evidence for A. phagocytophilum infection in a cat. The arrows in A and B indicate the ehrlichia-like inclusions inside the neutrophilic granulocytes in a cat with anaplasmosis. The inclusions can appear as single (thick arrow) or as colonies (morulae) in a cytoplasmic vacuole. Peripheral blood smear, May-Grünwald-Giemsa, original magnification × 1000.

Antibodies against A. phagocytophilum can be examined by IFA test [17,33], ELISA [10,34], or western immunoblot assay [35]. In experimentally infected cats, seroconversion occurred at the earliest within 14 days after infection [28]. At the control visit, the present cat showed positive antibody titer despite doxycycline therapy. Various case reports showed that all cats seroconverted in the course of the disease and that treatment with antibiotics did not prevent the seroconversion [5,17,36]. Antibody titers can remain high during the months after infection regardless of antibiotic treatment [5,17].

Interpretation of serological results can be confusing, due to seronegativity in the acute stage of the disease, persisting high antibody titers, and possible cross-reactivity with antibodies to other ehrlichial bacteria. To verify the infection by serology only, both acute and convalescent serum samples should be examined [35]. In humans and dogs, a 4-fold increase in the antibody titer should be detected in 4 weeks [35,37]. Evaluation of the evidence for cross-reactivity between A. phagocytophilum and other ehrlichial bacteria in cats is confusing, due to reclassification of the genera in 2001 [1,38]. In cases of feline anaplasmosis in which the diagnosis was confirmed by PCR, no cross-reactivity was detected with Ehrlichia canis and Neorickettsia risticii [5,17]. However, although uncommon, cross-reactivity exists in dogs [39]. Cross-reactivity with antibodies to the more closely related bacterium Anaplasma platys is likely [40,41], but there is only limited evidence of feline A. platys infection [35].

PCR analysis is a direct and reliable method for confirming the diagnosis in the acute stage of anaplasmosis [42]. The analysis is most often made from peripheral blood samples, but bone marrow or splenic tissue can also be used [30]. Samples for PCR analysis should be taken before treatment [35]. In cats experimentally infected with A. phagocytophilum, DNA could be detected from blood and bone marrow from 7 to 11 days after infection [28].

Most of the numerous PCR assays developed for the detection of A. phagocytophilum use the 16 S rRNA or the outer surface protein msp2 genes as targets [30]. The sensitivities and specificities vary among the different assays and primers; some also detect DNA from other closely related bacteria [30,43].

Anaplasma phagocytophilum is resistant to various antibiotics, including beta-lactam and macrolide compounds, sulfonamides, lincosamides, carbapenem antibiotics, and aminoglycosides [44-47]. In addition, its sensitivity to chloramphenicol is poor [44,45,48]. Tetracyclines, mainly doxycycline, are considered to be the antibiotics of choice for treatment [39,47]. Rifampin and fluoroquinolones are effective against A. phagocytophilum in vitro [45-47]. Rifampin led to clinical cure in human anaplasmosis [49,50], while relapse was reported after fluoroquinolone therapy [51].

Oral doxycycline 10 mg/kg/day for 20 - 30 days and oral tetracycline 22 mg/kg every 8 h for 21 days can be used to successfully treat anaplasmosis in cats [5,17]. Doxycycline should be given with water or food to prevent esophageal strictures [52]. If the cat is anorectic, antibiotic treatment can be started intravenously [5,17], but phlebitis was reported after intravenous doxycycline administration [17]. In acute illness the response to treatment is rapid and seen in 24 - 48 hours [17,39]. The owner of the present cat reported that the symptoms resolved in a few days. However, infection may persist for months despite treatment, and treatment with tetracyclines, even for 30 days, may not be adequate for elimination of the pathogen in cats. Conversely, complete recovery without antimicrobial treatment was reported [17]. In murine experimental studies and in a natural case of human anaplasmosis, previous infection with A. phagocytophilum did not prevent infection. However, the clinical course of the disease can be milder and of shorter duration [53,54].

The prevalence of anaplasmosis is increasing in both animals and humans [30,55]. The increase may be a result of several factors, including growing awareness of vectorborne diseases and how global climate change affects the distribution and prevalence of reservoir animals and vectors. Despite the increased prevalence of anaplasmosis in general, feline anaplasmosis is infrequently diagnosed. Although this can partly be related to the rapid elimination of ticks due to delicate grooming [56], the pathogenicity of tickborne pathogens in cats requires further research.

Conclusions

This feline case is the first reported A. phagocytophilum infection in any companion animal in Finland. Anaplasma phagocytophilum infection should be considered as a differential diagnosis in cats suffering from an acute febrile illness with previous tick exposure.

Consent

Written informed consent was obtained from the owner for publication of this case report. A copy of the written consent is available for review by the Editor-in-Chief of this journal.

Competing interests

The authors declare that they have no competing interests.

Authors' contributions

HMH carried out the clinical examination and treatment of the present cat and is the main author of this paper. AB and AM carried out the molecular diagnostics, while AB provided the pictures, and assisted to draft the manuscript. KP and TS reviewed the draft and helped to write the final version. All authors have read and approved the final manuscript.

Acknowledgements

We acknowledge Professor Olli Vapalahti and M.Sc. Essi Hasu from the Veterinary Faculty of Helsinki University for helpful consultation. Furthermore, we would like to thank the laboratory staff of the Institute of Comparative Tropical Medicine and Parasitology of Munich for support in performing the examinations, and M.Sc. Jukka Partanen for his invaluable help in editing the pictures.

References

  1. Dumler JS, Barbet AF, Bekker CPJ, Dasch GA, Palmer GH, Ray SC, Rikihisa Y, Rurangirwa FR: Reorganization of genera in the families Rickettsiaceae and Anaplasmataceae in the order Rickettsiales: unification of some species of Ehrlichia with Anaplasma, Cowdria with Ehrlichia and Ehrlichia with Neorickettsia, descriptions of six new species combinations and designation of Ehrlichia equi and 'HGE agent' as subjective synonyms of Ehrlichia phagocytophila.

    Int J Syst Evol Microbiol 2001, 51(6):2145-2165. PubMed Abstract | Publisher Full Text OpenURL

  2. Stuen S: Anaplasma phagocytophilum-the most widespread tick-borne infection in animals in Europe.

    Vet Res Commun 2007, 31:79-84. PubMed Abstract | Publisher Full Text OpenURL

  3. Bellström L: Fästingburna rickettsioser.

    Sven Veterinartidn 1989, 41:549-553. OpenURL

  4. Bjöersdorff A, Christenson D, Johnsson A, Sjöström AC, Madigan JE: Ehrlichia equi-infektion diagnostiserat hos häst.

    Sven Veterinartidn 1990, 42:357-360. OpenURL

  5. Bjöersdorff A, Svendenius L, Owens J, Massung R: Feline granulocytic ehrlichiosis - a report of a new clinical entity and characterisation of the infectious agent.

    J Small Anim Pract 1999, 40(1):20-24. PubMed Abstract | Publisher Full Text OpenURL

  6. Liz JS, Anderes L, Sumner JW, Massung RF, Gern L, Rutti B, Brossard M: PCR detection of granulocytic ehrlichiae in Ixodes ricinus ticks and wild small mammals in western Switzerland.

    J Clin Microbiol 2000, 38(3):1002-1007. PubMed Abstract | PubMed Central Full Text OpenURL

  7. Jenkins A, Handeland K, Stuen S, Schouls L, Van de Pol I, Meen RT, Kristiansen BE: Ehrlichiosis in a moose calf in Norway.

    J Wildl Dis 2001, 37(1):201-203. PubMed Abstract | Publisher Full Text OpenURL

  8. Petrovec M, Bidovec A, Sumner JW, Nicholson WL, Childs JE, Avsic-Zupanc T: Infection with Anaplasma phagocytophila in cervids from Slovenia: evidence of two genotypic lineages.

    Wien Klin Wochenschr 2002, 114(13-14):641-647. PubMed Abstract OpenURL

  9. Hulinska D, Langrova K, Pejcoch M, Pavlasek I: Detection of Anaplasma phagocytophilum in animals by real-time polymerase chain reaction.

    APMIS 2004, 112(4-5):239-247. PubMed Abstract | Publisher Full Text OpenURL

  10. de la Fuente J, Torina A, Caracappa S, Tumino G, Furlá R, Almazán C, Kocan KM: Serologic and molecular characterization of Anaplasma species infection in farm animals and ticks from Sicily.

    Vet Parasitol 2005, 133(4):357-362. PubMed Abstract | Publisher Full Text OpenURL

  11. Petrovec M, Lotric Furlan S, Zupanc TA, Strle F, Brouqui P, Roux V, Dumler JS: Human disease in Europe caused by a granulocytic Ehrlichia species.

    J Clin Microbiol 1997, 35(6):1556-1559. PubMed Abstract | PubMed Central Full Text OpenURL

  12. Strle F: Human granulocytic ehrlichiosis in Europe.

    Int J Med Microbiol 2004, 293(Suppl):27-35. PubMed Abstract OpenURL

  13. Tuomi J: Studies in epidemiology of bovine tick-borne fever in Finland and a clinical description of field cases.

    Ann Med Exp Biol Fenn 1966, 44(Suppl 6):1-62. PubMed Abstract OpenURL

  14. Courtney JW, Kostelnik LM, Zeidner NS, Massung RF: Multiplex real-time PCR for detection of Anaplasma phagocytophilum and Borrelia burgdorferi.

    J Clin Microbiol 2004, 42(7):3164. PubMed Abstract | Publisher Full Text | PubMed Central Full Text OpenURL

  15. Lin Q, Rikihisa Y, Felek S, Wang X, Massung RF, Woldehiwet Z: Anaplasma phagocytophilum has a functional msp2 gene that is distinct from p44.

    Infect Immun 2004, 72(7):3883. PubMed Abstract | Publisher Full Text | PubMed Central Full Text OpenURL

  16. Alekseev AN, Dubinina HV, Van De Pol I, Schouls LM: Identification of Ehrlichia spp. and Borrelia burgdorferi in Ixodes ticks in the Baltic regions of Russia.

    J Clin Microbiol 2001, 39(6):2237-2242. PubMed Abstract | Publisher Full Text | PubMed Central Full Text OpenURL

  17. Lappin MR, Breitschwerdt EB, Jensen WA, Dunnigan B, Rha JY, Williams CR, Brewer M, Fall M: Molecular and serologic evidence of Anaplasma phagocytophilum infection in cats in North America.

    J Am Vet Med Assoc 2004, 225(6):893-896. PubMed Abstract | Publisher Full Text OpenURL

  18. Ogden NH, Bown K, Horrocks BK, Woldehiwet Z, Bennett M: Granulocytic Ehrlichia infection in Ixodid ticks and mammals in woodlands and uplands of the U. K.

    Med Vet Entomol 1998, 12(4):423-429. PubMed Abstract | Publisher Full Text OpenURL

  19. Stefanidesova K, Kocianova E, Boldis V, Kostanova Z, Kanka P, Nemethova D, Spitalska E: Evidence of Anaplasma phagocytophilum and Rickettsia helvetica infection in free-ranging ungulates in central Slovakia.

    Eur J Wildl Res 2008, 54(3):519-524. Publisher Full Text OpenURL

  20. Bjoersdorff A, Bergstrom S, Massung RF, Haemig PD, Olsen B: Ehrlichia-infected ticks on migrating birds.

    Emerg Infect Dis 2001, 7(5):877-879. PubMed Abstract | Publisher Full Text | PubMed Central Full Text OpenURL

  21. Makinen J, Vuorinen I, Oksi J, Peltomaa M, He Q, Marjamaki M, Viljanen MK: Prevalence of granulocytic Ehrlichia and Borrelia burgdorferi sensu lato in Ixodes ricinus ticks collected from Southwestern Finland and from Vormsi Island in Estonia.

    APMIS 2003, 111(2):355-362. PubMed Abstract | Publisher Full Text OpenURL

  22. von Stedingk LV, Gurtelschmid M, Hanson HS, Gustafson R, Dotevall L, Engvall EO, Granstrom M: The human granulocytic ehrlichiosis (HGE) agent in Swedish ticks.

    Clin Microbiol Infect 1997, 3(5):573-574. PubMed Abstract | Publisher Full Text OpenURL

  23. Jenkins A, Kristiansen BE, Allum AG, Aakre RK, Strand L, Kleveland EJ, van de Pol I, Schouls L: Borrelia burgdorferi sensu lato and Ehrlichia spp. in ixodes ticks from southern Norway.

    J Clin Microbiol 2001, 39(10):3666-3671. PubMed Abstract | Publisher Full Text | PubMed Central Full Text OpenURL

  24. Ravnik U, Tozon N, Strasek K, Avsic Zupanc T: Clinical and haematological features in Anaplasma phagocytophilum seropositive dogs.

    Clinical Microbiology and Infection 2009, 15:39-40. PubMed Abstract | Publisher Full Text OpenURL

  25. Granquist EG, Bårdsen K, Bergström K, Stuen S: Variant -and individual dependent nature of persistent Anaplasma phagocytophilum infection.

    Acta Vet Scand 2010, 52(1):25. PubMed Abstract | BioMed Central Full Text | PubMed Central Full Text OpenURL

  26. Kohn B, Galke D, Beelitz P, Pfister K: Clinical features of canine granulocytic anaplasmosis in 18 naturally infected dogs.

    J Vet Intern Med 2008, 22(6):1289-1295. PubMed Abstract | Publisher Full Text OpenURL

  27. Tarello W: Microscopic and clinical evidence for Anaplasma (Ehrlichia) phagocytophilum infection in Italian cats.

    Vet Rec 2005, 156(24):772-774. PubMed Abstract | Publisher Full Text OpenURL

  28. Foley JE, Leutenegger CM, Stephen Dumler J, Pedersen NC, Madigan JE: Evidence for modulated immune response to Anaplasma phagocytophila sensu lato in cats with FIV-induced immunosuppression.

    Comp Immunol Microbiol Infect Dis 2003, 26(2):103-113. PubMed Abstract | Publisher Full Text OpenURL

  29. Lilliehöök I, Egenvall A, Tvedten HW: Hematopathology in dogs experimentally infected with a Swedish granulocytic Ehrlichia species.

    Vet Clin Pathol 1998, 27(4):116-122. PubMed Abstract | Publisher Full Text OpenURL

  30. Carrade DD, Foley JE, Borjesson DL, Sykes JE: Canine granulocytic anaplasmosis: a review.

    J Vet Intern Med 2009, 23(6):1129-1141. PubMed Abstract | Publisher Full Text OpenURL

  31. Lewis GEJ, Huxsoll DL, Ristic M, Johnson AJ: Experimentally induced infection of dogs, cats, and nonhuman primates with Ehrlichia equi, etiologic agent of equine ehrlichiosis.

    Am J Vet Res 1975, 36(1):85-88. PubMed Abstract OpenURL

  32. Buoro IB, Atwell RB, Kiptoon JC, Ihiga MA: Feline anaemia associated with Ehrlichia-like bodies in three domestic short-haired cats.

    Vet Rec 1989, 125(17):434-436. PubMed Abstract | Publisher Full Text OpenURL

  33. Rikihisa Y: The tribe Ehrlichieae and ehrlichial diseases.

    Clin Microbiol Rev 1991, 4(3):286-308. PubMed Abstract | PubMed Central Full Text OpenURL

  34. Magnarelli LA, Bushmich SL, IJdo JW, Fikrig E: Seroprevalence of antibodies against Borrelia burgdorferi and Anaplasma phagocytophilum in cats.

    Am J Vet Res 2005, 66(11):1895-1899. PubMed Abstract | Publisher Full Text OpenURL

  35. Greene CE: Ehrlichiosis, neorickettsiosis, anaplasmosis, and Wolbachia infection. In Infectious Diseases of the Dog and Cat. 3rd edition. Edited by Winkel A, Stringer S. Canada: Elsevier; 2006:203-232. OpenURL

  36. Engvall EO, Egenvall A: Granulocytic ehrlichiosis in Swedish dogs and horses.

    Int J Med Microbiol 2002, 291:100-103. PubMed Abstract | Publisher Full Text OpenURL

  37. Bakken JS, Dumler S: Human granulocytic anaplasmosis.

    Infect Dis Clin North Am 2008, 22(3):433-48.

    viii

    PubMed Abstract | Publisher Full Text OpenURL

  38. Stubbs CJ, Holland CJ, Reif JS, Wheeler S, Lappin MR: Feline ehrlichiosis.

    Comp Cont Ed Pract Vet 2000, 22(4):307-317. OpenURL

  39. Neer TM, Breitschwerdt EB, Greene RT, Lappin MR: Consensus statement on ehrlichial disease of small animals from the Infectious Disease Study Group of the ACVIM.

    J Vet Intern Med 2002, 16(3):309-315. PubMed Abstract OpenURL

  40. Brouqui P: Anaplasma platys (Ehrlichia platys) infection in a dog in France: description of the case, and characterization of the agent.

    Revue Méd Vét 2002, 153(2):85-90. OpenURL

  41. Inokuma H, Fujii K, Matsumoto K, Okuda M, Nakagome K, Kosugi R, Hirakawa M, Onishi T: Demonstration of Anaplasma (Ehrlichia) platys inclusions in peripheral blood platelets of a dog in Japan.

    Vet Parasitol 2002, 110(1-2):145-152. PubMed Abstract | Publisher Full Text OpenURL

  42. Edelman DC, Dumler JS: Evaluation of an improved PCR diagnostic assay for human granulocytic ehrlichiosis.

    Mol Diagn 1996, 1(1):41-49. PubMed Abstract | Publisher Full Text OpenURL

  43. Massung RF, Slater KG: Comparison of PCR assays for detection of the agent of human granulocytic ehrlichiosis, Anaplasma phagocytophilum.

    J Clin Microbiol 2003, 41(2):717. PubMed Abstract | Publisher Full Text | PubMed Central Full Text OpenURL

  44. Klein MB, Nelson CM, Goodman JL: Antibiotic susceptibility of the newly cultivated agent of human granulocytic ehrlichiosis: promising activity of quinolones and rifamycins.

    Antimicrob Agents Chemother 1997, 41(1):76. PubMed Abstract | PubMed Central Full Text OpenURL

  45. Horowitz HW, Hsieh TC, Aguero-Rosenfeld ME, Kalantarpour F, Chowdhury I, Wormser GP, Wu JM: Antimicrobial susceptibility of Ehrlichia phagocytophila.

    Antimicrob Agents Chemother 2001, 45(3):786-788. PubMed Abstract | Publisher Full Text | PubMed Central Full Text OpenURL

  46. Maurin M, Bakken JS, Dumler JS: Antibiotic susceptibilities of Anaplasma (Ehrlichia) phagocytophilum strains from various geographic areas in the United States.

    Antimicrob Agents Chemother 2003, 47(1):413-415. PubMed Abstract | Publisher Full Text | PubMed Central Full Text OpenURL

  47. Branger S, Rolain JM, Raoult D: Evaluation of antibiotic susceptibilities of Ehrlichia canis, Ehrlichia chaffeensis, and Anaplasma phagocytophilum by real-time PCR.

    Antimicrob Agents Chemother 2004, 48(12):4822-4828. PubMed Abstract | Publisher Full Text | PubMed Central Full Text OpenURL

  48. Tuomi J: Experimental studies on bovine tick-borne fever. 5. Sensitivity of the causative agent to some antibiotics and to suplhamezathine.

    Acta Path et Microbiol Scandinav 1967, 71:109-113. Publisher Full Text OpenURL

  49. Buitrago MI, Ijdo JW, Rinaudo P, Simon H, Copel J, Gadbaw J, Heimer R, Fikrig E, Bia FJ: Human granulocytic ehrlichiosis during pregnancy treated successfully with rifampin.

    Clin Infect Dis 1998, 27(1):213-215. PubMed Abstract | Publisher Full Text OpenURL

  50. Krause PJ, Corrow CL, Bakken JS: Successful treatment of human granulocytic ehrlichiosis in children using rifampin.

    Pediatrics 2003, 112(3):e252-253. PubMed Abstract | Publisher Full Text OpenURL

  51. Wormser GP, Filozov A, Telford SR III, Utpat S, Kamer RS, Liveris D, Wang G, Zentmaier L, Schwartz I, Aguero-Rosenfeld ME: Dissociation between inhibition and killing by levofloxacin in human granulocytic anaplasmosis.

    Vector Borne Zoonotic Dis 2006, 6(4):388-394. PubMed Abstract | Publisher Full Text OpenURL

  52. McGrotty YL, Knottenbelt CM: Oesophageal stricture in a cat due to oral administration of tetracyclines.

    J Small Anim Pract 2006, 43(5):221-223. Publisher Full Text OpenURL

  53. Horowitz HW, Aguero-Rosenfeld M, Dumler JS, McKenna DF, Hsieh T, Wu J, Schwartz I, Wormser GP: Reinfection with the agent of human granulocytic ehrlichiosis.

    Ann Intern Med 1998, 129(6):461-463. PubMed Abstract | Publisher Full Text OpenURL

  54. Levin ML, Coble DJ, Ross DE: Reinfection with Anaplasma phagocytophilum in BALB/c mice and cross-protection between two sympatric isolates.

    Infect Immun 2004, 72(8):4723-4730. PubMed Abstract | Publisher Full Text | PubMed Central Full Text OpenURL

  55. Parola P: Tick-borne rickettsial diseases: emerging risks in Europe.

    Comp Immunol Microbiol Infect Dis 2004, 27(5):297-304. PubMed Abstract | Publisher Full Text OpenURL

  56. Breitschwerdt EB: Canine and feline anaplasmosis: emerging infectious diseases. In Proceedings of 2nd Canine Vector-Borne Disease Symposium April 25-28 2007, Mazaro del Vallo. Bayer Animal Health: Leverkusen; 2007:6-15. OpenURL